PROTOCOL

 

A modification of the protocol as described by Caporaso et. al (2011) is used and is available upon request.

 

The V3-V4 primers are used as follows:

 

~341F (forward primer)

AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTCCTACGGGAGGCAGCAG

 

~806R (reverse primer)

CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNNNAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT

 

Sequences of the primers are in bolded italics
12 N’s (in red) designate barcode sequences
These primers are slightly different from those primers used by Illumina.